• Ils ne savaient pas que c’était impossible, alors ils l’ont fait !

    Ils ne savaient pas que c'était imposible, alors ils l'ont fait !

  • Méta

  • Visiteurs

    Il y a 11 visiteurs en ligne
  • Mes albums récents

    • Album : action 1er juillet
      <b>DSC_4011</b> <br />
    • Album : action 25 juin
      <b>DSC_3915</b> <br />
    • Album : Solidarité avec les personnels d e la santé
      <b>1</b> <br />
    • Album : Montage de l'expo pap chap à Montreuil
      <b>DSC05659</b> <br />
    • Album : Manif au havre le 24 janvier
      <b>20200124_095506</b> <br />
    • Album : Manif 15 janvier
      <b>DSC_3525</b> <br />
    • Album : actions du 14 janvier
      <b>DSC05505</b> <br />
    • Album : Manif 28 decembre
      <b>20191228_145507</b> <br />

Les retraités pap chap

*

Déclaration de la section syndicale CGT retraité-e-s Chapelle-Darblay.

Les membres du bureau de la section syndicale des retraité-e-s de la Chapelle-Darblay, réunis le 3 juillet 2020,

Après avoir fait un point sur la cessation d’activité de l’usine et le licenciement de son personnel, tiennent à témoigner  leur soutien indéfectible à l’équipe syndicale.

Les retraité-e-s CGT, seront toujours présents aux côtés des élus Chapelle-Darblay pour défendre le site, éviter la fermeture d’une usine moderne qui fait vivre des centaines de familles.

Les retraité-e-s CGT, seront toujours présents pour répondre à toute forme d’aide, de combat pour l’emploi dans un bassin industriel déjà fortement touché.

Les membres du bureau rappellent que toute la CGT doit être présente pour défendre les salarié-e-s qui se sont toujours battus pour faire vivre ce site papetier, novateur avec sa matière première recyclée,  ses procédés tournés vers l’avenir et ses nombreux métiers de haute technicité nécessaires à la fabrication du papier journal.

Les défenseurs de l’Ecologie, de l’industrie, de l’emploi doivent, ensemble, soutenir ce site indispensable à l’économie régionale et nationale et par conséquent trouver, ensemble, une solution industrielle pérenne, garante du maintien et du développement de l’emploi.

Le maintien de l’outil industriel, pendant une année, est une première victoire qui doit en appeler d’autres.

Grand-Couronne, le 3 juillet 2020

*

Compte rendu de notre dernière assemblée générale.

INTERVENTION DE     Christian STEPHAN du 7 février 2020

unnamedTout d’abord, il nous faut excuser Philippe Sabin et Jean-François Gabala et Bienvenue à Julien Sénécal du syndicat des actifs, secrétaire du CSE et secrétaire adjoint du syndicat CGT.

Chers amis, chers camarades

La coutume veut que nous vos présentions nos meilleurs vœux.

Aujourd’hui, dans ce climat où les libertés sont menacées, les acquis sociaux balayés, la volonté d’appauvrissement des salariés, des retraités et de bien d’autres, il est difficile de souhaiter une bonne année… seule la santé est un véritable vœu car s’indigner ne suffira pas, il va falloir résister.

Alors oui ! une bonne santé pour faire de 2020 une bonne année.

Au cours de cette réunion j’avais prévu d’aborder 3 points essentiels, la sécu, la retraite et Chapelle-Darblay, mais profitant de la participation de Julien, je lui passerai la parole pour parler de la situation de Chapelle.

La sécuvoeux_2020_UFR-600x300

Donc pour la sécu, c’est un pillage systématique, un travail de sape, notamment en lui imposant de nouvelles dépenses et pour maintenir un budget de nouvelle économie.

Economie dans les hôpitaux, pour les dépenses de santé. La réduction ou le non remboursement des médicaments, avec pour exemple l’homéopathie ; des restes à charge toujours plus importants

De nouvelles dépenses qui consistent à faire supporter à la Sécu les exonérations de charges et de cotisations notamment sur les heures supplémentaires et/ou les primes de fin d’année. On utilise nos cotisations à d’autres fins que les prestations sociales, les retraites, la santé, les allocations, les accidents du travail etc. Des cadeaux de 40 milliards aux plus riches avec l’allègement des cotisations et la hausse de la CSG pour les travailleurs et les retraités.

Bref, le gouvernement fait main basse sur la Sécu, pour mieux la privatiser et faire supporter des frais et taxes supplémentaires aux mutuelles.

Les banques, les assurances et toutes les fausses mutuelles sont à l’affut et attendent avec impatience le basculement de cette grande conquête des travailleurs dans le giron des capitalistes.

Toutes les réformes illustrent la logique implacable et cynique de Macron qui conduit inévitablement et autoritairement à la casse de la sécu pour que nous nous tournions vers le secteur marchand et privé.

La suppression de la retraite par répartition au profit d’une retraite par point, et j’en parle aussitôt après, le durcissement des conditions d’accès à l’assurance chômage et la diminution des prestations, sont les éléments à combattre.

2019_11_00_InfoCom-CGT_4-pages-retraitesLa retraite,

L’objectif est de baisser de 25% les pensions avec un système à points basé sur les 25 années de travail. Et comme le seul chiffre connu décidé par Macron et son gouvernement est que le montant des retraites soit bloqué à 14% du PIB. Donc s’il y a plus de personnes qui partent à la retraite le gâteau pour chacun diminuera.

Les exemples viennent des pays qui sont passés à ce système : la Suède les salariés ont perdu 7 % sur leur retraite

Ce n’est pas tout, car le gouvernement n’a pas renoncé à allonger la durée du travail jusqu’à 64, 65, 66 ans… en l’agrémentant de malus pour ceux qui voudront absolument partir plus tôt et d’un bonus pour ceux qui veulent travailler plus longtemps. Mais combien sont-ils ceux qui pourront avoir une retraite en bonne santé et avec les moyens suffisants pour se loger, se soigner et même manger…

C’est pourquoi nous disons :

Non à la contre-réforme des retraites, non au système universel par points, maintien et amélioration de tous les régimes existants.

Non à l’allongement de la durée de vie au travail, non à l’allongement de cotisation, non au recul de l’âge de la retraite !

Non au calcul de la retraite sur l’ensemble de la carrière

Mais, la retraite c’est une aubaine pour le patronat qui ne veut pas de mesures de pénibilité. Si bien que le « compte pénibilité » s’est vu renommer : « compte professionnel de prévention », et beaucoup de critères ont disparu de la liste. D’autre part, la retraite minimum à 1000 euros n’est qu’un leurre, car il faudra avoir une carrière pleine pour ouvrit ce droit.

En regardant de plus près, on s’aperçoit que les points AGIRC/ARRCO n’ont pas suivi l’évolution du coût de la vie, ni celle des salaires. De 2013 à 2017, le point (car c’est un système à points) n’a jamais été revalorisé et en 2018, seulement de 0.60%, mais si on compare l’évolution par rapport à la valeur précédente, elle baisse de 0.10%.

Alors, on voit bien que le système à points, et ses accompagnements, n’est fait que pour baisser le niveau des pensions et orienter, ceux qui le pourront, vers un système de capitalisation.

 

Maintenant je passe la parole à Julien sur Chapelle-Darblay…

Julien nous a informé de la situation de notre Chapelle Darblay et tous les risques malheureusement encourus, tant industriels que sociaux. Sans entrer dans les détails, mais l’ensemble du bureau des retraités Chapelle Darblay et l’ensemble des syndiqués présents, ont assuré leur soutien total au syndicat cgt des actifs.

Merci Julien avant de passer la parole pour la suite à Francis pour l’activité de la section et à André pour les comptes.

 

 

Je vous demanderai de faire une minute de silence à propos du décès de Jean Pierre Carpentier.     Merci.

 

 

Christian finit son intervention en nous informant de sa décision d’arrêter ses responsabilités syndicales.

Alors, je voulais vous dire, j’ai été pendant de nombreuses années à la tête du syndicat CGT, puis de la section des retraités. J’ai vécu une vie militante très enrichissante, mais l’heure est venue de laisser la place à une équipe rajeunie, plus dynamique que mon âge me le permet.

Je vous dis merci pour mon parcours, pour tout ce que vous m’avez appris. Merci pour votre engagement et votre confiance. Je reste un fervent militant, et tant que je le pourrai, je serai à vos côtés dans les luttes quotidiennes pour défendre nos acquis et sauver Chapelle Darblay.

 

Avant la discussion je passe la parole à Francis, qui nous fait état du rapport d’activité de la section.

Voici un petit exposé sur les différentes activités que nous avons eues durant l’année 2019.lacroix.com_-250x125

Chaque mois, en principe le 1er vendredi, réunion mensuelle du bureau, ouverte à tous.

Fin janvier – début février, organisation de l’assemblée générale de notre section avec remise des cartes et des timbres pour l’année et un colis.

Nous avons élaboré un courrier à donner ou envoyer aux futurs retraités syndiqués.

C’est un appel à rester syndiqué dans la section des retraités.

Vous en avez un exemplaire sous les yeux, nos principales activités y sont répertoriées.

Nous envoyons un courrier aux adhérents à chaque appel à manifester quand les retraités sont concernés.

Nous avons aussi participé à toutes les initiatives initiées par le syndicat des actifs pour la sauvegarde de leur emploi et du site.

Ces manifestations sont annoncées sur le blog.

Nous participons et faisons participer toute personne volontaire à la journée festive organisée par l’UD CGT retraités.

Celle-ci a lieu à un endroit différent chaque année, le matin ; il y a des activités différentes, marche ou visite culturelle, le midi repas, et d’autres activités l’après-midi, pétanque, danse ….

On s’assure aussi que chacun reçoive bien les publications, comme « le lien » publication gratuite de l’UD CGT ou « vie nouvelle », publication nationale payante uniquement en direction des retraités et leurs spécificités.

 

André, notre trésorier, nous informe de la bonne santé financière de notre section, qui nous permet de voir loin devant nous.

 

Le bureau sera cette année de 7 membres, puisque Gérard Sénécal et Jean Francois Gabala rejoignent Francis François, André Desaunay, Erick Duval, Philippe Sandras et Daniel Duhamel.

 

Une discussion tous azimuts s’est ouverte entre tous les présents, qui ont en tous profité pour saluer et remercier Christian. Chacun évoquant les souvenirs de toutes leurs années passées ensemble dans notre usine, dans notre syndicat et dans toutes les luttes menées ensemble. Et nous sommes remontés loin dans le temps puisque était présent notre doyen René Etienne qui a aujourd’hui 90 ans.

Gérard a tenu à saluer Chritian et le remercier pour tout ce qu’il a fait pour notre Chapelle Darblay, pour la cgt. Pour tout ce qu’il lui a appris lorsqu’il l’a remplacé à la tête du syndicat et toutes les valeurs de la cgt qu’il lui a transmises, encore Merci à toi et bonne continuation.

*

*

*

*

*

*

 

Union Fédérale des Retraités

ENSEMBLE N°94   22 décembre 2019

Les retraités pap chap Capture-d’écran-2019-06-26-à-10.47.51

Tous ensemble…

1993, 2003, 2007, 2010 : autant de réformes en série qui, selon les chantres de la société libérale, étaient sensées permettre de sauver notre système de retraites en allongeant, évidemment, la durée de travail aussi bien du public que du privé.

Pour mémoire, notre système, un des meilleurs au monde, est à prestations définies, fondé sur la répartition, sur la solidarité intergénérationnelle et est composé de régimes de base ou spéciaux en annuités issus de luttes sociales.

Alors, sous couvert d’équité, opposant les salariés du public à ceux du privé et avec l’aide des médias, le gouvernement, le patronat et la CFDT proposent de fondre les 42 régimes de retraites existants en un seul régime en instaurant un système de retraite à points intégral, (Arrco et Agirc étant un exemple de régime en points) tout en raflant, au passage, les sommes excédentaires de certains régimes dits spéciaux.

La mobilisation du 5 décembre a prouvé, si besoin était, que les salariés, les retraités, dans leur immense majorité, ne sont pas dupes. Un simple calcul d’une retraite par points par rapport aux 25 meilleures années de travail ne fait pas de doute.

Alors luttons tous ensemble car sinon, une fois de plus, le perdant sera…

Ne nous faisons pas d’illusions, le but est de permettre aux systèmes bancaires et assurantiels de mettre en place un système de santé et de retraite par capitalisation. Car, ce qui est également en jeu, c’est l’avenir de la Sécu, le but étant de nous amener vers une couverture maladie à minima, le restant étant gérer par les tenants de la finance.

Quitte à me répéter, nous sommes tous concernés par cette bataille, même si le discours gouvernemental se veut rassurant. En effet, il est clairement affiché que, si cette réforme devait passer, la part de la richesse consacrée aux retraites restera bloquée sous le seuil des 14 % du PIB.

Voilà les faits, mais les causes sont rarement évoquées.

Une des causes principales est la crise du système économique actuel qui, pour survivre, n’a comme variable d’ajustement et comme objectif que la disparition de notre modèle social, précariser actifs et retraités,  aidé en cela par la politique gouvernementale qui privatise, sur l’autel du système capitaliste, des pans entiers de fleurons industriels et de services rentables qui nous appartiennent.

La CGT a des propositions, des revendications. Malheureusement, trop souvent les documents contenant ces propositions et revendications restent dans les cartons au sein des UD ou UL, voire dans nos syndicats.

Quid de la bataille des idées ? Et comment argumenter et mener la bataille des idées ? Quelques pistes : l’amélioration de la situation de l’emploi et du pouvoir d’achat ; que l’État compense les cadeaux de cotisations sociales qu’il fait au patronat ; que l’on supprime les parachutes dorés et autres retraites chapeau ; que l’on mette à contribution les revenus du capital… dans un premier temps.

Le XIe congrès de notre UFR, qui s’est tenu en septembre, a été un riche moment de partage et d’amitié mais également d’orientations. Notre CN des 19 et 20 novembre a réfléchi à la manière le plus efficace possible de les mettre en application.

Il nous faut également préparer le Congrès fédéral ainsi que celui de l’UCR, sachant que les deux se tiendront en 2020. Du pain sur la planche !

En attendant, l’UFR et moi-même vous souhaitent, à vous et à vos proches, d’excellentes fêtes de fin d’année.

Ensemble94-250x354

 

*

Les élus CGT de la section des retraités CGT Chapelle Darblay

ruban-noir-deuilont la tristesse de vous faire part du décès

de Mr Jean Pierre CARPENTIER.

Ancien secrétaire du comité d’établissement Chapelle Darblay Gd Couronne

Ancien responsable mutuelle 

Ancien trésorier de notre section,

Nous adressons nos plus sincères condoléances à toute sa famille,

en particulier à son épouse et ses enfants,

nous avons une grosse pensée pour Christelle (ancienne employée

du comité d’établissement).

*

Son inhumation aura lieu le 20 novembre à 11h15 au crématorium d’Evreux.

Union Fédérale des Retraités

Ensemble93-1ENSEMBLE N°93      12 novembre 2019

l’intégralité du  11 ème congrès des retraités cgt Filpac  dans le PDF ci dessous

Un congrès se termine

Un congrès, c’est un grand moment de rencontres, de partage et d’amitié. On en ressort ragaillardi, remonté et rassuré ; on s’y est dit et on a constaté que nous ne n’étions pas les seuls à penser ce que nous pensions et qu’il fallait lutter pour contrer cette politique et ces politiciens au service du capital, source d’inégalités, de misère, de souffrances, pour une classe ouvrière qui ne sait même plus qui elle est, et dont les choix électoraux, quand elle fait un choix, vont à l’encontre de ses intérêts.

La xénophobie, le racisme, le fascisme, le terrorisme, plan B du capital pour combattre ceux qui dénoncent les dérives de nos sociétés qui se tournent vers la guerre en mettant sur les routes des millions de gens fuyant la misère et les atrocités. Sociétés qui nous conduisent vers une catastrophe climatique, plutôt que de renoncer à des profits immédiats.

Tout cela fut abordé, et tout cela fut condamné.

Dans un congrès, on y adopte une feuille de route pour les trois années qui suivent en espérant qu’au bout de cette route nous obtiendrons les progrès sociaux et sociétaux qui nous font défaut et que nous réussirons à protéger ceux qui nous restent encore.

Pour ce qui concerne la France, cette route est semée d’embûches, car détruire tout ce que les luttes ouvrières ont apporté comme amélioration des conditions d’existence des citoyens, des salariés, des ouvriers, voilà à quoi Macron, le Président des riches, s’emploie sans relâche, malgré une contestation sociale grandissante, mais qui peine à s’organiser, qui peine à organiser la riposte contre la démolition d’un système de société où la solidarité jouait un rôle moteur.

La casse organisée de nos services publics de santé, de prévoyance, d’éducation, de transport, de loisirs, les bas salaires et la précarité transforment la  vie des plus démunis en une vie de misère, alors que la richesse de quelques-uns s’étale ouvertement sans vergogne. Quelle société !

Pourtant, nous avions obtenu des avancées sociales, puisqu’on veut aujourd’hui nous les supprimer…

Alors ? Oui, mais c’était au temps où les syndicats étaient puissants, reconnus, parce que les adhérents y étaient nombreux. C’était au temps où la classe ouvrière était représentée dans l’hémicycle d’un Palais Bourbon où la droite ne laissait pourtant pas sa place.

Alors ? Renforcement, renforcement, renforcement !

Redonnons des moyens à notre syndicat, aux syndicats, aux partis politiques représentatifs de ce que nous sommes afin qu’ils puissent animer véritablement la vie politique nationale et peser sur les choix de notre société.

Réveiller les consciences, rencontrer, distribuer, coller, discuter, dénoncer, proposer, convaincre, s’unir, faire adhérer, lutter ensemble, vaste programme qui demande du temps, des militants, mais qui est nécessaire pour contrer la propagande gouvernementale et patronale distillée à grand renfort de médias.

Rejoignons-nous, unissons-nous, retroussons nos manches, car le capital est vorace.
Si nous ne faisons rien, nous n’aurons rien de plus, mais nous perdrons beaucoup.

*

*

*

*

*

*

*

* le 8 octobre !

Pour l’augmentation des pensions, tous en action le 8 octobre !

« Le pouvoir d’achat des retraités en chute libre depuis 25 ans » !                                        fichier pdf tract_unit_08.10

Emmanuel Macron a été stoppé par les fortes mobilisations des retraitées et retraités,

Emmanuel Macron a cédé en trois fois sur une partie de nos revendications

Nous connaitrons bientôt l’évolution de nos pensions et l’ampleur des reculs du Président Emmanuel Macron :

tout sera dans le projet de loi de financement de la Sécurité sociale (PLFSS) 2020

que le Parlement votera en fin d’année.

*

*

*Le 8 octobre, soyons des centaines de milliers dans la rue,

pour que le gouvernement décide enfin de maintenir notre pouvoir d’achat, de rattraper tout ce que nous avons perdu depuis 2013.

C’est possible, nous avons déjà fait un peu céder le gouvernement, il nous faut continuer.

 

 

manif 8 octobre

*

Union fédérale des retraités de la Filpac-Cgt

ENSEMBLE N°92

29 juin 2019

Capture-d’écran-2019-06-26-à-10.47.51
Européennes   Et le gagnant est…  

Le grand capital… et le RN. Bonnet blanc et blanc bonnet.

Malheureusement pas les forces progressistes. Il faut bien le reconnaître, le monde du travail, les retraités, les classes populaires, les chômeurs, les jeunes, n’ont pas, majoritairement, et c’est un doux euphémisme, adhèré aux différents programmes des partis dits de gauche. D’autant plus que ces résultats surviennent après six mois de manifestations sociales menées, entre autres, par les gilets jaunes, chez lesquels on a pu relever bon nombre de revendications que porte la CGT.

Pourquoi ? C’est la grande question et les réponses sont multiples.

Certes un électeur sur deux s’est abstenu. Est-ce par rejet de la politique ?

Tous des pourris ?

Nombre de jeunes se sont tournés vers le parti écologiste, qui, dans son programme, ne conjugue cependant pas justice sociale et urgence écologique ?

Nous pourrions, à l’UFR, comme bon nombre de syndicats, nous cacher derrière le petit doigt et répéter à l’envi que le syndicalisme n’a pas à̀ se mêler de politique. Ces « puristes » oublient un peu vite que notre principal adversaire-décideur reste le gouvernement, qui, pour le moment, défend les intérêts du grand capital, du monde de la finance, des lobbies, du patronat.

Nous sommes près de 16 millions d’électeurs, et si nous parvenions à̀ convaincre les retraités de s’engager pour le progrès social au détriment de la rentabilité́ financière et du seul profit, cela serait un atout, un rapport de force de poids, un vrai pouvoir.

Pourquoi avons-nous du mal à faire passer nos idées ?

Même si dans l’Acte II de son quinquennat le président Macron veut, dixit

« […] Transformer notre manière de faire […] et remettre l’homme au cœur, l’humanité au cœur, je ne veux pas commettre la même erreur […] », il nous enfume. On change d’étiquette, mais le contenu, à n’en pas douter, sera du même tonneau. Pas question de s’attaquer au capital.

Ce qui nous attend, ce qui attend les actifs au travers de la réforme des retraites, n’augure rien de bon. Le gouvernement annonce la couleur : déficit de la Sécurité sociale, rallonger la durée du temps au travail, j’en passe et pas des meilleurs. Et pourtant rien que d’arrêter de supprimer des postes chez les fonctionnaires, dans le privé, sans parler des exonérations de cotisations sociales, permettrait de rééquilibrer les caisses de la Sécu.

Autre information : selon le COR, les retraités sont mieux lotis que les actifs en 2019, mais moins bien dès 2025.

Dans ce contexte, à quoi peut servir le syndicalisme et, en ce qui nous concerne, le syndicalisme retraité UFR ? Réponse facile : je vous propose de prendre connaissance du rapport d’activité qui sera présenté lors de notre congrès du 23 au 27 septembre à Nouan-le-Fuzelier par Jean-Pierre Ghiotto.

Pas suffisant toutefois.

La CGT a tenu son congrès. Y avons-nous trouvé des réponses lors des débats ? D’après nos camarades qui y ont participé ce congrès leur a semblé un congrès de réélection et un congrès où le débat d’idées a plutôt été verrouillé.

L’UFR, comme souligné plus haut, tiendra son congrès, courant septembre, avant celui de la Fédération qui aura lieu, lui, en 2020.

Ce sera le moment où nous pourrons analyser notre activité passée, mais également débattre du document d’orientation dans lequel nous abordons l’évolution du syndicalisme, ses structures, les « relations » actifs-retraités, la continuité syndicale, nos besoins, nos revendications, le syndicalisme international.

Tout comme de la place de l’UFR au sein de la Fédération, le parti pris de l’avenir, même si, en ce qui nous concerne, une grande partie de notre avenir est derrière nous.

Ensemble92-1-768x1088

*

Union fédérale des retraité·es de la Filpac-Cgt

carteRetraite22mai19-uneLe Printemps des Retraité·es

3 juin 2019

M. LE PRÉSIDENT DE LA RÉPUBLIQUE

Contrairement à vos engagements, vous avez gravement mis en cause le pouvoir d’achat des retraités déjà attaqué par les gouvernements précédents : augmentation de 25 % de la CSG, désindexation des pensions que le gouvernement considère comme une allocation. Aucune revalorisation en 2018 malgré une inflation de 1,6 % et seulement 0,3 % en janvier 2019 pour une inflation estimée à 1,4 %. Les 1 % les plus riches verront leur pouvoir d’achat progresser de 6 % en 2019, celui des retraités aura reculé de 3 %.

Pour la grande majorité d’entre eux c’est un mois de pension en moins sur trois ans. Le rétablissement du pouvoir d’achat de tous les retraité-e-s est indispensable et urgent.

carteRetraite22mai19-une-768x553

Monsieur le président, nous vous demandons :

  • Le retour à l’indexation des pensions sur l’évolution des salaires
  • Une mesure immédiate de revalorisation de 3 % compensant la baisse récente de pouvoir d’achat des retraités
  • L’annulation de la hausse de CSG pour tous les retraité-e-s
  • Le maintien et le développement des services publics de proximité.

Pour envoyer la carte postale à l’Elysée, cliquez sur ce lien pour la télécharger au format pdf

Pour signer la pétition en ligne, cliquez sur ce lien

retraités es cgt

invitation    

Cher(e) camarade, et ami(e), 

L’USR (Union syndicale de Retraités CGT de Seine Maritime) organise une journée festive.

                                                                    17 mai 2019. 

Notre section syndicale souhaite participer et vous faire participer à cette journée. 

-        Le matin des sorties sont organisées au choix. 

-        Un tournoi de pétanque ma-retraite-cgt-mont-de-marsan

-        Une petite randonnée pédestre de 6 km, départ 9h30 salle Maupassant, ou 

-        Visite du patrimoine du Trait -départ 9 h30 Salle Maupassant, ou 

-        Visite du musée O Seine départ 10h 15 salle Maupassant (supplément 4.50€) ensuite le midi 

-        Repas fraternel, avec animation musicale, (par François Callay) 

-        Grande tombola avec de nombreux lots 

Le midi, le repas est pris en charge par la section syndicale. 

L’après-midi, chacun s’occupera selon ses gouts : danse, pétanque, jeux de société, etc..  .. Il est possible d’organiser un covoiturage pour les personnes qui n’ont pas de moyen de transport.

Nous vous demandons de vous inscrire par téléphone auprès des personnes suivantes avant le 10 mai 2019.

                                         André DESAUNAY 06 35 15 50 21

                                         Francis FRANCOIS 06-73-&5-3-2-+5-

                                         Christian STEPHAN 06 80 62 14 86

 

Nous vous espérons nombreux pour cette journée. 

Amitiés syndicales le bureau

jour festif

1  342 5    98976

LE PRINTEMPS DES RETRAITÉS ET DES RETRAITÉES

DANS LA RUE LE JEUDI 1 1 AVRIL 2019

Un gouvernement sourd dingue !

Dès son arrivée à la présidence de la République M. Macron a attaqué les retraité-e-s : gel des pensions pour 2018 et 2019, augmentation de 25 % de la CSG, soit une perte de pouvoir d’achat de 5 % en deux ans ! Il a provoqué la colère, que plus de 200 000 personnes ont exprimé en manifestant le 15 mars 2018 à l’appel de nos neuf organisations.

Puis l’inflexibilité du gouvernement sourd dingue a provoqué une crise sociale profonde, l’irruption des gilets jaunes et, parmi elles et eux, de très nombreuses personnes retraitées présentes sur les ronds-points, dans les discussions et manifestations.

Toutes ces mobilisations ont contraint le gouvernement à tenter de calmer la colère acceptant d’annuler l’augmentation de la CSG pour une partie des retraité-e-s, de recevoir enfin une délégation de nos neuf organisations.

Le mécontentement persistant incite maintenant le gouvernement à envisager de respecter le code la Sécurité sociale, de revaloriser les pensions 2019 du montant de l’inflation . . . mais seulement pour les basses pensions.

Un gouvernement dingue de dons aux plus riches.

Le gouvernement ne remet pas en cause sa politique très inégalitaire :

L’augmentation de la CSG reste pour une partie des retraité-e-s. Le gouvernement tente de nous diviser en ne traitant pas tout le monde de la même façon. Il remet en cause le principe de nos systèmes de retraite solidaires par répaftition, dans lequel le fait de cotiser donne droit à une pension et une revalorisation.

Le bradage de biens publics à des « investisseurs privés », après les autoroutes, voilà les aéroports.

Les exonérations de cotisations sociales (famille, maladie, vieillesse, etc.) provoquent des difficultés financières de la Sécurité Sociale, qui poussent à des reculs de la couverture maladie, la politique familiale, les pensions, etc.

-            Nos neuf organisations sont reçues mais nos demandes ignorées : Gilles Le Gendre, président du groupe LREM de l’Assemblée Nationale, et Olivier Dussopt, secrétaire d’État auprès du ministre de l’Action et des Comptes publics, restent «dans la ligne » de la politique du gouvernement : énormes cadeaux aux grandes entreprises et à leurs actionnaires qui vident les caisses publiques, ce qui sert de prétexte à l’austérité pour les autres personnes, notamment retraitées.

Des revendications qui peuvent et doivent être satisfaites

De l’argent,Nous revendiquons :

il y en a !La suppression de la hausse de la CSG et des exonérations de cotisations sociales,

Nous demandons

 La revalorisation de toutes les pensions en fonction de l’ISF (4,5de l’évolution des salaires, le rattrapage des pertes

-            Le rétablissement milliards d’euros), l’imposition dessubies depuis 2014, dividendes à l’impôt progressif (10 milliards),Un minimum de pension à hauteur du SMIC pour une carrière complète ;

-            La fin du CICE (40 milliards en

2019),Le maintien et l’amélioration des pensions de réversion ;

-            La suppression de l’exit tax

(6 milliards),La prise en charge de la perte d’autonomie à 100 % par la Sécurité sociale et l’ouverture d’un droit universel dans le cadre d’un grand service public de  La lutte contre la fraude fiscale (au l’aide à l’autonomie. moins 100 milliards), etc.

LE 11 AVRIL,

RENDONS VISIBLES NOTRE COLÈRE ET NOS ÉXIGENCES !

ROUEN, 10h Place de l’hôtel de ville

*

le bureau 2019 des retraités Chapelle Darblay en photo.

DSC03303

*

le 19 mars 2019…

Toutes et tous ensemble !

rendez vous à 10h cours Georges Clemenceau 

19 mars

 

 

 

 

 

Union fédérale des retraités de la Filpac-Cgt

ENSEMBLE N°90

Hand click icon, bold line

21 décembre 2018

Bulletin trimestriel de l’Union fédérale des retraités de la Filpac-Cgt (lire plus)

logoUfr-384x288

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

   logo_ud-cgt-76fsulogo_fo_r_tsolidaire 76unef

C’est le moment ! Affirmons nos revendications

·     Hausse des salaires et des pensions,

Défense des emplois, de la Sécu et des retraites

Grève le 9 octobre

 Alors qu’il y a explosion des dividendes versés aux actionnaires :

       +13% de hausse au niveau mondial au 2ème trimestre (soit 493 milliards de dollars)

       + 23% de hausse en France au 2ème trimestre (soit 50,9 milliards d’€).

 Le Premier Ministre annonce de nouveaux cadeaux fiscaux (CICE, CIR…) pour les actionnaires, les patrons et les banquiers, qui touchent pourtant déjà « un pognon de dingue ».

 Pour les salariés, les retraités, les chômeurs, les jeunes et les familles populaires le gouvernement dicte une avalanche de mesures antisociales et d’appauvrissement :

       Gel des pensions et des prestations sociales, alors que l’inflation repart.

Projet de baisse très forte des allocations chômage.

Attaque contre la sécu et l’accès aux soins, au point d’envisager de supprimer les revenus pendant les arrêts de travail.

Destruction d’emplois, fermetures et privatisation dans les services publics (CAP 22).

Destruction d’emplois, restructurations, dans l’industrie et des secteurs tels le commerce 

Barrages contre le droit aux études et l’accès à l’Université pour les jeunes.

 Et le gouvernement Macron-Philippe, bien que discrédité, annonce un projet de loi pour imposer un « régime Universel de retraite par points ». Un ex premier Ministre expliquait : « Le système par point, en réalité, permet une chose qu’aucun homme politique n’avoue : baisser chaque année la valeur des points et diminuer le niveau des pensions » (déclaration de Fillon en 2016 devant les patrons).

 Le régime universel voulu par le gouvernement mettrait fin aux 42 régimes de retraite existants. Ce serait une individualisation ouvrant la voie à la capitalisation. Tous les salariés du public et du privé seraient perdants. Le gouvernement Philippe dévoilera le projet de loi devant les syndicats début octobrej

 L’heure est à la défense de toutes les conquêtes sociales, de tous les droits élémentaires aujourd’hui menacés. L’heure est à l’unité pour les revendications concernant les salaires, les emplois, et la protection sociale. La CGT, FO, Solidaires, FSU, l’UNEF et l’UNL, appellent à faire du 9 octobre prochain une puissante journée de mobilisation nationale et de grève interprofessionnelle, étudiante et lycéenne.

En Seine Maritime, la CGT, FO, Solidaires, la FSU, l’UNEF… appellent à préparer la GRÈVE et la mobilisation le 9 octobre, en organisant des diffusions auprès des salariés, des jeunes et de la population, en tenant des assemblées et des réunions d’information dans les entreprises et les services pour alerter sur les mesures en préparation, à discuter des revendications et des moyens d’agir le 9 octobre et au-delà si Macron et Philippe ne reculent pas.

*

Mardi 9 octobre

*

Tous en GRÈVE pour les revendications :

·        ·       Maintien des régimes de retraites : régime général, régimes spéciaux, régimes complémentaires, du Code des pensions civiles et militaires. NON au régime universel de retraite par points.

o   ·       Augmentation générale des pensions, des prestations sociales et des salaires. Non à l’augmentation de la CSG, notamment pour les retraités.

o   ·       Défense de la Sécurité sociale, défense de tous les droits tels l’arrêt maladie couvert par la Sécu. Non au basculement de la cotisation vers l’impôt CSG.

o   ·       Défense et développement des services publics. Arrêt des fermetures, des privatisations et des suppressions de postes donc Retrait des mesures du plan Action Publique 2022.

o   ·       Libre accès des bacheliers à l’université dans la filière de leur choix, abandon de Parcoursup.

o   ·       Maintien des droits ouverts pour les chômeurs, et de la gestion paritaire de l’assurance chômage.

o   ·       Défense des conventions collectives, de la hiérarchie des normes et des CHSCT, abrogation des lois Rebsamen, El Khomri, et des ordonnances Macron.

o   ·       Retrait du pacte ferroviaire qui détruit le statut des cheminots et prépare la privatisation en remettant en cause un service public ferroviaire de qualité.

o   ·       Non aux licenciements et aux suppressions de postes, maintien de tous les sites industriels, tertiaires et publics.

o   ·       Arrêt de toutes les poursuites patronales et judiciaires contre les syndicalistes, les salariés et les jeunes.

 

 

LE 9 OCTOBRE

Les retraités doivent exprimer leur solidarité, mais aussi

et surtout, leur ras le bol,

leur colère suite à leurs baisses de pensions déjà subies et celles à venir

*

 MANIFESTATION ROUEN 13 H 30     Cours Clémenceau

 

Il y aura peut-être la possibilité de se restaurer autour d’un barbecue à midi,

cela sera confirmé sur le blog de notre syndicat dès que possible.

 

 

 

 

 

 

 

 

deCGTCGTCGTCGTCGTCGTCGTCGTCGT

         

retraitesLe Gouvernement et sa majorité présidentielle n’ont rien compris à la colère des retraité-e-s

Le 28 septembre 2017, 80 000 manifestants retraité-e-s manifestaient contre l’annonce de la hausse  de  la CSG

Le 15 mars,  à l’appel  de 9 organisations, 200  000 retraité-e-s ont exprimé le mécontentement et la colère  de millions d’autres face  à cette  ponction  de CSG et exigé  la revalorisation de leurs pensions

Le gouvernement, obligé  de  tenir compte  de  la force de  ces rassemblements, imagine  qu’en annonçant un allègement de CSG pour certaines personnes fera taire la colère de millions de retraité-es mécontents.

Environ 100 000 ménages dont  le revenu fiscal de référence (RFF) se situe juste au-dessus du seuil retenu pour cette augmentation, soit 14 404 euros, seraient concernés.

Le comble  du mépris c’est que cette  décision  ne serait effective qu’en 2019 !!

Dans leurs circonscriptions,  les parlementaires font face à la colère de ces millions de retraité-es.

Loin d’être des « nantis » de la « génération dorée », les retraité-es  ne méconnaissent nullement la solidarité intergénérationnelle qu’ils pratiquent tous les jours dans leur entourage. Quand le gouvernement offre des milliards de cadeaux  fiscaux aux grands  patrons  et aux plus riches, c’est aux retraité-e-s qu’il demande de compenser la baisse  du pouvoir d’achat des salariés !!images

Exigeons:

Que le gouvernement et le parlement prennent, sans attendre, l’initiative d’une loi de finances rectificative qui :

  • annule  la hausse  de la CSG pour tous,
  • mette fin au gel des pensions
  • décide de leur revalorisation

Les pétitions seront remises  aux parlementaires et au gouvernement. Adresses utiles: Assemblée nationale1, 26 rue de l’Université 75355 Paris 07 SP – http://www.assemblee-nationale.fr     Sénat, Palais du Luxembourg 15 rue de Vaugirard, 75291 PARIS Cedex 06 – http://www.senat.fr

 

petition_2018_web

 

 

 

Retraites

 

Une réforme gouvernementale encore plus dangereuse pour les petites retraites !20180524_134730(0)

jeudi 24 mai 2018

Le 17 mai, la CGT a abordé avec le haut-commissaire aux retraites, M. Delevoye, les questions relatives aux dispositifs de solidarité (chômage, maladie, invalidité) actuellement inclus dans le système de retraite.

Pour la CGT, il faut impérativement renforcer les droits à retraite de ceux qui sont touchés par  le chômage et la précarité, la maladie ou l’invalidité ainsi qu’harmoniser vers le haut les minima de pension.

La rencontre a porté sur  les problèmes que posent  une éventuelle transition des dispositifs d’un système majoritairement par annuités à un système dit universel par points.

Or les trimestres assimilés des régimes de base, dans le privé par exemple, permettent d’atteindre la durée d’assurance requise et permettent des départs en retraite plus tôt et sans décote. Ils atténuent les inégalités persistantes au travail.

Sortir la solidarité de la retraite c’est plonger des dizaines de milliers de salariés en particulier les femmes, dans la misère.

Le haut-commissariat découvre peut-être que quand on veut, comme E. Macron, passer d’un système de retraite par annuités à un autre par points, ce n’est pas simple.

Il n’est pas juste nécessaire de prévoir la transcription  des trimestres validés en  nombre de points.

Le caractère plus étroitement contributif d’un système uniquement par points conduit à des besoins supplémentaires en volume des dépenses de solidarité.

Changer de système c’est difficile et c’est risqué !

C’est encore plus vrai pour les minima de pension.

Ainsi, un trimestre acquis pour un salaire de 40% du SMIC (150 heures de SMIC), et le calcul sur les meilleures années dans le privé permet d’éliminer de nombreuses périodes de précarité et donc d’élever le niveau des retraites de la sécurité sociale des salariés ayant connu le plus de difficultés.

Les montants consacrés à la solidarité doivent être prévus, ce qui n’est pas automatique dans un régime à points.

Par ailleurs, dans le privé toujours le minimum contributif (688 €) est très inférieur au seuil de pauvreté  (1015 € en 2017). La CGT revendique une pension minimum au SMIC net pour une carrière complète.

Or tous les partisans d’une retraite à points expliquent que les dépenses de solidarité ne doivent pas être intégrées à la cotisation. Le patronat exige sans doute encore une baisse des cotisations employeur pour la  retraite et plus largement la protection sociale.

L’absence d’objectifs sur le niveau de pension, récurrente dans les séances précédentes de concertation, et les incertitudes sur le volume des dépenses de solidarité, nous confirme, que cette réforme a pour premier objet de baisser les pensions encore plus rapidement que la baisse déjà  programmée par les gouvernements précédents.

Pour améliorer les dispositifs de solidarité des régimes et leur efficacité et leur montant, ce que la CGT revendique, il n’y a nul besoin d’une réforme systémique en points.

Montreuil, le 24 mai 2018

ma

 

retraite

CSG : pour les retraités c’est toujours  NON ! 

Des dizaines de milliers de personnes ont manifesté ce 15 mars à l’appel des 9 organisations nationales de retraités soussignées contre la hausse de la CSG et la baisse programmée de leur niveau de vie. 

Même si tous les chiffres ne nous sont pas encore parvenus, il apparaît clairement que la mobilisation a été une réussite éclatante et que le nombre de manifestants a plus que doublé : à Paris, ce sont 30 000 manifestants qui ont défilé de Montparnasse à la rue de Varenne, à quelques centaines de mètres de l’hôtel Matignon. A Marseille, à Nantes, Bordeaux, Lyon, La Rochelle, Angoulême, Grenoble, etc. les retraités sont descendus dans la rue massivement, au-delà même de ce qui était attendu par les organisateurs.

 En tout, ce sont plus de 162 points de rassemblement qui ont été recensés contre 120 lors de la journée du 28 septembre 2017, date de la précédente mobilisation des retraités. Un point exhaustif sera fait sous quelques jours.

Cette mobilisation exceptionnelle est à la mesure de la colère des retraités devant les refus répétés de nous recevoir du Président de la République, de Madame Buzyn et maintenant du Premier Ministre. A la mesure également de la morgue de ceux qui traitent les retraités de « génération dorée ».

 Loin d’être des « nantis », loin de méconnaître la solidarité intergénérationnelle qu’ils pratiquent tous les jours dans leur entourage, les retraités, soucieux de défendre la république sociale appellent d’ores et déjà à participer aux manifestations et actions organisées :

Le 22 mars 2018,

en défense des trois fonctions publiques et des services publics républicains. 

Paris, le 15 mars 2018. 

François Thiéry-Cherrier (UCR-CGT, 263 rue de Paris, 93515 Montreuil cedex)

Didier Hotte (UCR-FO, 141 avenue du Maine, 75680 Paris cedex 14)

Jacqueline Valli (UNAR-CFTC, 128 avenue Jean Jaurès, 93697 Pantin cedex)

Daniel Delabarre (UNIR CFE-CGC, 59 rue du Rocher, 75008 Paris)

Marylène Cahouet (FSU, 104 rue Romain Rolland, 93260 Les Lilas)

Gérard Gourguechon (UNIRS-Solidaires, 31 rue de la Grange aux Belles, 75010 Paris)

Michel Salingue (FGR-FP, 20 rue Vignon, 75009 Paris)

Francisco Garcia (Ensemble & Solidaires – UNRPA, 47 bis rue Kléber, 93400 St Ouen)

Jacques Sanchez (LSR, 263 rue de Paris, 93515 Mon

 

 

 

 

 

 

en pièce jointe

l’appel des neuf organisations de retraité.e.s afin de

manifester notre colère contre les mesures honteuses de Macron.

logo-cgtfichier pdf tract unitaire action 15 mars 2018

Tous en manif le 15 mars, nous devons faire entendre

notre colère et mécontentement

le 15 mars à 10h30, rendez au théâtre des Arts.

contre les mesures honteuses de Macron.

 

 

 

 

 

 

 

 

cgtCommuniqué de l’Union Confédérale des Retraités-e-s CGT 

Forte mobilisation des retraité-e-s dans tout le pays ! 

Il n’y a guère que la Préfecture de police de Paris pour nier l’évidence. Les retraités se sont fortement mobilisés dans tout le pays. Certaines villes ont rassemblé jusqu’à trois fois plus de manifestants que dans les précédentes manifestations. C’est un véritable succès qui a d’ailleurs trouvé un large écho dans les médias et fait débat dans tout le pays.

 Les retraités étaient 10 000 à Paris avec les responsables des 9 Organisations syndicales en tête de la manifestation. Ils étaient encore 3 000 à Lyon, 4 000 à Toulouse, 3 000 à Marseille, 3 000 à Bordeaux. Des villes plus modestes ont rassemblé, elles aussi, très largement. Ainsi ils étaient 400 à Rochefort, 500 à Saintes, 500 à Bourgoin. Plusieurs manifestations ont rassemblé 2 500 retraités dans le Finistère. Le recensement exhaustif des manifestations est en cours.

 Même si la convergence des salariés actifs, mobilisés sur leurs propres revendications, a contribué à faire grandir les cortèges, la mobilisation des retraités a été très supérieure à ce que nous avons observé ces 3 dernières années. Elle est le fait de la politique que le Président Macron et son Gouvernement veulent imposer aux retraités, notamment avec la hausse de la CSG annoncée et déjà une année « blanche » pour la hausse des pensions en 2018. La hausse de + 0,8 % des pensions au 1er octobre, pour l’année 2017, ne fait que compenser l’inflation des seuls 12 derniers mois et est loin de compenser la perte de pouvoir d’achat des retraités et l’est d’autant moins avec… la hausse de la CSG.

A nos demandes répétées de rendez-vous, le Président de la République a répondu en nous renvoyant à Madame Buzyn, Ministre de la Santé et des Solidarités. La rencontre s’est tenue jeudi 28 septembre avec l’ensemble des Organisations syndicales. L’échange avec la Ministre confirme que les retraités n’ont pas de Ministre de tutelle, ni d’interlocuteur pour être entendus.

 L’Intersyndicale des 9 va se revoir très rapidement pour proposer le prolongement de l’action.

Montreuil, le 29 septembre 2017

LES RETRAITÉS VONT 28 SEPTEMBRE

Haro sur le pouvoir d’achat des retraités

Montrons que nous refusons la baisse des pensions

Non à la hausse de la CSG à 8,3% ! Revalorisation de nos pensions !

Journée nationale d’action et de mobilisation le 28 septembre

ma-retraite-cgt-mont-de-marsanSIGNEZ LA PETITION EN LIGNE ?   MERCI

Rendez vous devant le théâtre des arts à Rouen à 10H30.

 

 

ENSEMBLE N°84

Bulletin trimestriel de l’Union fédérale des retraités de la Filpac

lundi 26 juin 2017

ENSEMBLE N°84

PDF - 1.8 Mo

DÉCLARATION DU CONSEIL NATIONAL DE L’UFR FILPAC

lundi 19 juin 2017

ufrjpg-2eca12eca-bc665 Le Conseil National de L’Union Fédérale des Retraités de la Filpac-CGT, réuni à Montreuil les 13 et 14 juin 2017

Après un premier tour des élections législatives fortement marqué par une abstention (51,3%) jamais atteinte sous la Ve République, le score place en tête le parti du président Macron, avec 6,4millions de suffrages(14%) obtenus sur 45,7millions d’inscrits, qui suffisent néanmoins à laisser entrevoir une déferlante du parti présidentiel dans les travées de la prochaine assemblée avec une masse de députés inexpérimentés, caractérisés dans  leur immense majorité par une ignorance abyssale des sujets, sévèrement cornaqués par les vieux briscards issus de LR pour appliquer, au pas de charge et à la virgule près, les mesures anti sociales concoctées de longue date par le Medef.

Le Conseil National de L’Union Fédérale des Retraités de la Filpac-CGT, réuni à Montreuil les 13 et 14 juin 2017, partage sans réserve les analyses et commentaires qui ont fait l’objet de communiqués de la confédération et s’insurge contre le démantèlement annoncé de 120 ans de droit du travail, la fin des conventions collectives, la fin du contrat de travail.

Si, comme c’est fortement probable, le scénario du pire pour les salariés se confirme, nous tenons à les alerter sur l’augmentation de la CSG, qui impactera lourdement le pouvoir d’achat des retraités déjà en berne (ils n’ont pas vu augmenter leurs pensions depuis avril 2013, soit il y a plus de quatre ans !) et le saccage du système de retraite par répartition.

Il n’est pas inutile de rappeler que sur le plan de la fiscalité, le gel du barème des impôts depuis 2011, jusqu’aux pseudos modifications de 2015, s’accompagnent des dispositions suivantes :

  • -Suppression de la demi-part supplémentaire accordée aux veufs et veuves.
  • -Fiscalisation du supplément de 10% pour les retraités ayant eu trois enfants ou plus.
  • -Suppression de la demi-part supplémentaire pour les retraités ayant élevé seul un enfant pendant au moins 5 ans.
  • -Instauration de la contribution additionnelle de solidarité pour l’autonomie (CASA) d’un montant de 0,3% sur les retraites imposables.
  • -Augmentation de la TVA.
  • -Augmentation de la CSG qui est passée à 6,6% contre 3,8% précédemment.

Une nouvelle hausse de 1,7% la CSG, dans le but de financer les allocations des non-salariés (par exemple les auto-entrepreneurs), aux dépens des retraités est préconisée dans le programme présidentiel. Ainsi, 600 000 retraités percevant entre 10 173 et 29 359 euros par an auraient une hausse moyenne de la CSG comprise entre 526 et 1046 euros annuellement selon leur tranche d’imposition.

Une réforme des retraites devrait être élaborée à la fin de l’année pour être votée début 2018 :  C’est en réalité un changement systémique. Il s’agirait de mettre rapidement en place un régime unique par points, faisant basculer le système à prestations définies, dont les conditions sont connues (taux de remplacement, années de cotisations, âge légal de départ à la retraite) vers un système à cotisations définies où seul le niveau des recettes est fixé. Les retraités devant se partager les sommes disponibles. Les retraités supporteraient ainsi tous les risques liés aux changements de contexte économique. Et ce dispositif technique, fixé une fois pour toutes, échapperait au débat politique !

Les retraités français qui ont l’expérience des régimes par points, avec l’Agirc et l’Arrco, ont vu baisser le rendement de ces régimes complémentaires de 30% en deux décennies, et un système analogue est appliqué depuis 1999 en Suède, où la baisse continue des pensions et les reculs successifs de l’âge de départ à la retraite provoquent une vague de contestation. D’ailleurs le 1er ministre Suédois déclarait, en février 2012, que les actifs devraient travailler jusqu’à 75 ans s’ils voulaient bénéficier du même niveau de retraite qu’en 2011. Le président Macron se qualifie lui-même et en toute modestie de « Président Jupitérien ». Nous lui rappellerons qu’il n’y a pas loin du Capitole à la Roche Tarpéienne.

Sans aucun doute possible les retraités qui ont largement contribué, par des luttes incessantes, à bâtir le modèle social français que ce gouvernement rétrograde et réactionnaire veut dynamiter, se mobiliseront massivement pour s’engager résolument dans l’énorme mouvement de révolte populaire qui s’annonce contre ces projets régressifs.

Montreuil, le 14 juin 2017

Déclaration de l’Union Confédérale des Retraités CGT 

cgtHAUSSE DE LA CSG POUR LES RETRAITES,

C’EST NON      !

C’est au pas de charge que le Président de la République s’est engagé dans un recul social sans précédent contre le droit du travail, l’emploi et la protection des salariés et des chômeurs.

C’est aussi un coup sans précédent qu’il veut porter contre l’ensemble des retraités avec l’augmentation de la CSG.

Dans sa volonté de baisser le coup du travail, il veut donner l’illusion de donner du pouvoir d’achat aux salariés, en supprimant les cotisations maladies pour prendre dans la poche des retraités, en dynamitant le régime solidaire de la Sécurité sociale et de l’assurance chômage.

Emmanuel Macron aurait pu faire un autre choix : augmenter le Smic ou décider d’organiser des négociations salariales dans les branches. Alors que des milliards continuent à être distribués, principalement aux grandes entreprises, sans aucun effet sur l’emploi, ou que la fraude et l’évasion fiscales privent le budget de l’Etat de près de 150 milliards, le Président de la République ne montre aucune volonté politique de s’attaquer vraiment aux paradis fiscaux et aux multiples cadeaux aux plus riches.

Si le « gain » pour le pouvoir d’achat des salariés sera modeste, ce sera encore un nouveau coup porté au pouvoir d’achat des personnes en retraite qui, depuis plusieurs années, ont subi une baisse des revenus sous le double effet du gel des pensions et de l’augmentation de leur fiscalité spécifique.

Prendre dans la poche des retraités pour donner aux salariés au nom de la solidarité intergénérationnelle, c’est vouloir ignorer que les retraités contribuent largement, quand ils le peuvent, déjà aux dépenses de leurs enfants et petits-enfants et que les priver d’une partie de leur pension n’améliorera pas leur situation.

Mais c’est aussi de la manière la plus odieuse vouloir opposer les jeunes, les salariés aux retraités. Non les retraités ne sont pas des nantis !

Le Premier Ministre veut rassurer les retraités en leur annonçant une baisse de la taxe d’habitation. Il s’agit d’une mesure démagogique non financée car l’Etat, depuis longtemps, ne compense plus réellement les conséquences de ses propres décisions. Ces exonérations de taxe d’habitation accentueront les difficultés des Collectivités locales pour assurer les services publics répondant aux besoins de la population dont les retraités.

L’Union Confédérale des Retraités est bien décidée à créer toutes les conditions permettant de mobiliser les retraités pour défendre leur pouvoir d’achat, défendre la Sécurité sociale à laquelle nous sommes tous si attachés.

Montreuil, le 16 juin 2017

STOP A LA CASSE DE NOTRE SERVICE PUBLIC ET


cgtDE NOTRE SECURITE SOCIALE !


PLUS D’EMPLOIS DEVIENT VITALE !

 

fichier pdf 16 06 17 fermeture carsat – Copie

le 23 mai journée festive pour les retraités CGT*

*Affiche Fete USR  MAI 2017 fichier pdf Letttre journée festive 2017

*

ENSEMBLE N°83 Bulletin trimestriel de l’Union fédérale

des retraités de la Filpac

lundi 10 avril 2017             ENSEMBLE N°83

PDF - 2.9 Mo

Les Organisations de retraités

vous appellent à vous mobiliser le jeudi 30 mars

à 10h30 devant le théâtre des Arts

lundi 6 mars 2017

Haro sur les pensions de retraite !

Neuf Organisations syndicales et Associatives appellent les retraité·e·s à une nouvelle journée de mobilisation nationale sous des formes multiples dans les départements (manifestation, rassemblement, etc…) le 30 mars.

UFRappel30mac648-a374c

*

*

*

*

*

*

*

 *Le film  La SOCIALE sera diffusé le 31 mars à 20h30 à  l’espace Aragon de Oissel.

à voir absolument ( prix approximatif 5€)

la-sociale_gilles-perret

*

*

*

*

*

*

ENSEMBLE     N°82 Bulletin trimestriel de l’Union fédérale

des retraités de la Filpac

vendredi 3 février 2017

ma-retraite-cgt-mont-de-marsan

PDF - 547.4 ko

fichier pdf Ensemble82Site010217

*

*

*

*

*

*

*

*

*

*

*

Communiqué de l’Union Confédérale des Retraités CGT

GRIPPE : DES MILLIERS DE PERSONNES AGEES DECEDEES,

CE N’EST PAS UNE FATALITE !

 

 

L’épidémie de grippe fait des ravages chez les personnes âgées. Déjà de nombreux cas de décès sont annoncés.

Le danger était connu. Déjà en 2015, le nombre de décès était supérieur à la période de la canicule de 2003. Et si l’on parle des nombreux décès en établissement, qu’en est-il de toutes ces personnes âgées décédées au domicile ? Personne ne peut en ce 21ème siècle accepter tous ces décès comme une fatalité.01

Les personnes âgées sont extrêmement vulnérables. Contrairement aux autres classes d’âge, le nombre d’hospitalisations continue à croître. Cette épidémie montre l’ampleur de dégradation de notre système de santé qui n’est même plus capable de répondre à une banale épidémie de grippe.

L’ampleur de l’épidémie, si elle révèle une nouvelle fois un manque d’anticipation, marque surtout les limites d’une politique de casse de la Sécurité sociale, de l’hôpital avec les milliers d’emplois supprimés, les milliers de lits fermés, la course à la rentabilité. La situation est telle que la Ministre de la Santé est amenée à reconnaitre qu’il faut déprogrammer des hospitalisations pour libérer des lits, mais n’a pas l’intention de revenir sur sa politique menée depuis des années

Madame Touraine ose dire que les hôpitaux, s’ils sont en situation de tension, ne sont en aucun cas débordés. Pendant ce temps, des malades attendent des heures sur des brancards dans les urgences. Combien de personnes âgées restent des heures à attendre de trouver un lit ! Par exemple, des attentes interminables aux urgences entraînent une surmortalité de personnes les plus faibles, particulièrement chez les plus âgées.

La Loi de financement de la Sécurité sociale 2017, votée en début d’année, conforte la désorganisation de notre système de santé. Elle participe à la mise en œuvre de la Loi de modernisation du système de santé et de la recomposition des établissements publics de santé, de leur regroupement en GTH et suppression de lits et de places.

Il faut rompre avec une approche comptable de gestion de la Sécurité sociale, des hôpitaux.

Nous avons besoin d’une autre ambition : la reconquête de la Sécurité sociale, tant en matière d’assurance maladie, de retraite, de famille, de perte d’autonomie que de financement.

Cela passe notamment par d’autres orientations en matière de financement de la Sécurité sociale, en remettant en cause le dogme de la baisse du « coût du travail » et en mettant à contribution les revenus financiers des entreprises.

Pour gagner face à ces enjeux, nous devons amplifier la mobilisation autour de l’exigence d’une autre politique de santé et de protection sociale.

Pour cela, l’UCR appelle l’ensemble des retraités à participer massivement aux rassemblements et initiatives d’action dans les départements le 7 mars, à l’appel des Fédérations des Organismes sociaux et de la Santé et Action sociale avec l’Intersyndicale CGT/FO/SUD.

 

Montreuil, le 18 janvier 2017

 

*

*

*

*

*

*

*

*

*

*

*

Compte rendu Assemblée générale des retraités CGT Chapelle Darblay du 17 janvier 2017 à 13h30.

Introduction de Gérard Sénécal.

Explications de la nouvelle organisation. 

Réunion du bureau : chaque 1er vendredi du mois, (pourrait devenir aussi une matinée de permanence).

Nouveau lieu : les locaux CGT de l’entreprise.

Nouvelle communication : blog du syndicat avec page retraités et informations par courrier.

Point sur l’entreprise, fait Jf Gabala délégué syndical : être positif, pour cela mettre en valeur le savoir faire du personnel.

Essayer d’organiser des assises du papier que le gouvernement actuel nous a toujours refusé, peut être la venue de notre secrétaire général Ph Martinez avec notre fédération..

fête du papier le 1er Mai.

Toujours rien sur les investissements promis, production malgré tout de papier d e bonne qualité et résultat positif de plus de 4 M €.

Point sur l’actualité de nos retraites.

Gel des pensions depuis 2013.

1/2 part supprimée pour les impôts.

Exonérations supprimées sur la taxe d’habitation (pour les + de 65 ans) sur la taxe foncière (pour les + de 75 ans).

Depuis 2005, les retraités subissent une perte de pouvoir d’achat d’au moins 15 %

Informations sur la mutuelle : après négociation, la direction de Chapelle Darblay avec nos élus CGT ont opté pour le choix de notre mutuelle, c’est donc un gros renfort d’adhérents.

la mutuelle rencontre actuellement un souci informatique et n’au pu délivré une carte mutuelle annuelle, ce sera fait dans les prochains jours en tout cas pour la fin du mois.

point sur les finances :  explications sur les soucis rencontrées avec la poste pour clôturer notre compte et rejoindre le crédit mutuel.

la cotisation 2017 : pas d’augmentation cette année mais proposition appuyée d’adhérer au journal vie nouvelle. a ce stade 8 nouvelles adhésions et 9 abonnements nouveaux.

Propositions de moments conviviaux : distribution d’un cadeau exceptionnel en cette nouvelle année, faire une 2ème réunion semestrielle, avec moment festifs (barbecue, apéritifs dinatoire, etc…)

Il s’est tenu un débat sur la syndicalisation et sa poursuite lors du passage à la retraite.

il a été remis 2 médailles de fidélité à notre CGT à Jean pierre Carpentier ancien trésorier et membre du bureau  de notre section depuis 1991.

et à René Etienne le président d’honneur de notre assemblée.

la réunion s’est clôturée par le traditionnel pot de l’amitié et la dégustation de la galette.

Merci à tous pour votre participation, le renouvellement de vos adhésions et l’abonnement à notre journal de retraité qui fait également marcher le papier, encore bonne et heureuse année à toutes et tous et surtout bonne santé.

*

*

*

*

*

*

 

 

 

Assemblée générale des retraités CGT Chapelle Darblay

le 17 janvier 2017 à 13h30 dans nos locaux CGT à l’usine.

INVITATION

 Cher(e) camarade, et ami(e),

 Comme vous avez pu le constater, la restructuration de l’usine a amené le syndicat CGT des retraités à faire évoluer sa structure et son fonctionnement pour accueillir les nouveaux salariés mis à la retraite ou sortis en portage par l’entreprise.

 Le nouveau bureau se réunit tous les débuts du mois pour faire le point et décider des projets répondre aux évènements qui se font jour, organiser les actions futures. Le but étant de ressouder les liens de solidarité, de fraternité pour apporter à tous les adhérents plus d’efficacité dans nos actions, dans la convivialité, dans la solidarité.

 Forcément cela exige des changements pour s’adapter au mieux pour mener nos actions, sans tirer un trait sur les activités passées, mais en tirant des enseignements pour essayer d’intéresser tous nos syndiqués et diffuser les vraies valeurs de la CGT Chapelle-Darblay.

Donc, désormais :

 Le lieu de nos rencontres, de nos réunions mensuelles, de nos assemblées se tiennent dans les locaux de la CGT à Grand-Couronne

 Pour maintenir le côté amical de nos rencontres, de nos discussions, il sera organisé des moments conviviaux autour d’un repas, d’un apéro, d’une collation ou autres afin, si possible, que ceux-ci soient accessibles à tous.

 De communiquer davantage au travers le blog de la CGT, où se trouve un encart pour les retraités, et pour celles et ceux qui ne possèdent pas un ordinateur par une information courrier dont il faudra discuter de la périodicité.

 De vous interroger sur ce qui peut vous intéresser (en tenant compte de nos moyens financiers, évidemment)

 Par conséquent :

 Nous vous invitons à assister à une réunion

 

ASSEMBLEE GENERALE  Mardi 17 JANVIER 2017 à 13 h 30

AU LOCAL SYNDICAL CGT à GRAND-COURONNE 

ORDRE DU JOUR:

Reprise des cartes et la remise des timbres 2017

(Sur ce point il n’est pas envisagé d’augmentation de la cotisation, mais nous vous demandons de réfléchir à l’incorporation dans cette cotisation l’abonnement à « Vie Nouvelle » qui représente 1.35 euros par mois)

 La remise de médailles aux camarades qui ont souhaités de ne plus prendre de responsabilités au sein de la section.

Une intervention des responsables de la sections et du syndicat CGT

Une interrogation pour connaître ce que vous attendez de la section CGT des retraités

A l’occasion de votre adhésion, un cadeau vous sera remis et en conclusion nous aurons la satisfaction de lever le verre de l’amitié en dégustant la galette des rois.

 En cas d’impossibilité d’assister à cette assemblée, vous pouvez faire prendre votre carte par un camarade, ou vous pouvez régler le montant de votre cotisation, soit par chèque bancaire ou CCP, libellé au nom de la :

SECTION C.G.T. des retraités CHAPELLE DARBLAY GRAND COURONNE 

Et d’adresser votre versement à Monsieur DESAUNAY 

En attendant d’avoir le plaisir de vous rencontrer toutes et tous, nous vous souhaitons de très bonne fête de Noël et nos vœux de bonheur, de santé et de solidarités pour l’année 2017

 Bien syndicalement les responsables du syndicat CGT des retraités 

Pour tous renseignements, vous pouvez écrire à 

Monsieur SENECAL Gérard

7 rue Pierre et Marie CURIE

76530 GRAND-COURONNE

 

Monsieur STÉPHAN Christian

35 RUE Jean RACINE

76800 SAINT ETIENNE DU ROUVRAY

 

Monsieur DESAUNAY André

36 rue Léon JOUHAUX

76120 GRAND-QUEVILLY

 

Monsieur FRANCOIS Francis

3 allée Augusto SANDINO

Les Essarts

76530 GRAND-COURONNE

*

*

*

 

*

Déclaration CGT


« La CGT a refusé de signer l’accord du 30 octobre 2015 considérant qu’il s’agissait d’un accord perdant-perdant pour les salariés et les retraités.


Nous en avons l’illustration aujourd’hui à l’occasion de la réunion de notre Conseil d’Administration qui doit fixer les paramètres de fonctionnement applicables aux années 2016 et 2017.


La non revalorisation de la valeur du point en ARRCO au 1er novembre 2016 va  amplifier les difficultés pour vivre des retraités avec des pensions gelées depuis 2013, c’est-à-dire depuis 3 ans.


En s’appuyant sur les prévisions du gouvernement d’une inflation de 0,8 % pour 2017, c’est une année supplémentaire de gel des pensions qui se prépare avec l’application stricte de l’accord du 30 octobre 2015.


Il faudrait donc attendre le 1er novembre 2018 pour espérer une augmentation de la retraite complémentaire, soit une attente de 5 ans.


La chute du taux de remplacement du salaire par la pension va en conséquence s’accélérer.


Même si les salariés ne peuvent pas en évaluer les conséquences, il ne fait aucun doute que l’accord s’avère particulièrement préjudiciable pour les jeunes  générations qui subiront l’intégralité des effets, ainsi que pour les salariés aux carrières impactées par le chômage et la précarité. S’ajoute en effet au gel de la  valeur des points acquis, la hausse de 3,4 % du prix d’achat du point qui a pour conséquences moins de points pour un même salaire et donc une chute du niveau  des futures pensions.

De surcroit, ces 3,4 % ne correspondent pas à l’application de l’accord AGIRC ARRCO du 30 octobre 2015 selon lequel l’indice à appliquer est  obtenu en majorant de 2 % et non pas de 2 points l’évolution du salaire moyen pris comme référence. Il s’ensuit que tout cotisant est fondé à réclamer la  régularisation de son compte de points.


Par ailleurs, notre organisation remarque que toutes les organisations syndicales de retraités ainsi que des associations réclament la revalorisation des pensions.


C’est le bon sens qui s’exprime et qu’il faut écouter.


C’est pourquoi les administrateurs CGT votent contre les propositions faites pour fixer les paramètres 2016 et 2017. »


Le conseil d’administration décide (quatre votes contre de la délégation CGT) de maintenir, à compter du 1er novembre 2016, la valeur du point  ARRCO à son niveau fixé au 1er avril 2015, soit 1,2513 €, et de fixer la valeur du salaire de référence de l’ARRCO pour 2017 à 16,1879 €.

*

*

*

*

*

*

*

*

*

APPEL des 9 organisations de retraités es.

MOBILISATION le 29 Septembre 2016

pour une véritable revalorisation de nos retraites et pensions dès le 1er octobre 2016.

4

5

Le 30 juin 2016   Repas des retraités CGT

Bonjour à tous et merci de votre participation.

Je voudrais remercier la présence de Jean François Gabala secrétaire du C.E. qui illustre le lien nécessaire entre actifs et retraités.

Un petit mot avant tout chose.  Vous avez vu qu’il y avait des évolutions dans notre section.

Depuis le début de l’année nous avons mis en place un collectif pour réfléchir à ce que pouvait devenir le syndicat des retraités après le plan de licenciements et de mise en retraite ou en portage qui concerne un grand nombre de nos camarades, d’une part, et d’autre part, pour tenir compte du désir de certains de ne plus exercer de fonction au sein de la section.

A ce moment, je voudrais remercier Jean-Pierre Carpentier qui jusqu’ici a tenu la trésorerie de la section et a permis son fonctionnement.

Après la réflexion qui a eu lieu dans ce collectif le syndicat des retraités a été modifiés en visant plusieurs objectifs :

1)    Un rajeunissement des responsables, outre mon maintien temporaire dans le bureau, nous accueillons aux postes des responsabilité Gérard Sénécal ancien secrétaire du syndicat excusé, François Francis excusé à la rencontre de son fils au Canada, André Desaunay, Erick Duval et Daniel Duhamel également dirigeant de la mutuelle, tous ici présents.

Sans oublier le Président d’honneur de la section, René Etienne qui du haut de ses 86 ans est toujours fidèle à la CGT. 

2)    Essayer de créer plus de de fraternité, de convivialité, en fonction de nos moyens matériel et financier et surtout plus de solidarité entre les retraités et les actifs, notamment pour défendre l’usine et nos droits à un mieux vivre.

 3)    Etablir un dialogue par le biais du blog du syndicat qui a créé à notre intention un espace d’information et de discussions, et par des réunions plus fréquentes dans les locaux du syndicat, par la relance de la feuille d’information, etc.

4)    Et enfin de retrouver une véritable autonomie décisionnelle lors de la remise des cartes qui se fera désormais dans nos locaux à Grand-Couronne, autour d’une réception amicale et festive.

Voilà, nous pouvons lever notre verre à l’amitié et merci encore.

Les participants :Me M AUVARD, M STEPHAN, M DESANAY, M ETIENNE, Me CORBIN, Me M BAILLEUL, Me M MAUGER, M DUVAL, M GABALA, Me M COLLAS, M DUHAMEL, Me M CARPENTIER, Me M LEROUX, Me M VASSE

SONY DSC SONY DSC SONY DSC SONY DSC SONY DSC SONY DSC SONY DSC

*

*

*

*

Compte rendu de la dernière réunion du collectif retraités,

bienvenue au nouveau bureau et nouvelle section Retraité es    Chapelle Darblay.

COMPTE-RENDU RÉUNION

DU 8 juin 2016

À l’ordre du jour :

 Mise en place du collectif : qui fait quoi ?

Contrôle de la liste des envois de courrier

Repas CGT de fin de semestregilets rouge retraites

Le congrès des retraités CGT

Date de la prochaine réunion

Questions diverses

 

Présents : ERICK DUVAL ; GERARD SENECAL ; FRANCOIS FRANCIS : ANDRE DESAUNAY ; CHRISTIAN STEPHAN :                                              DUHAMEL DANIEL excusé

 Mise en place du collectif : qui fait quoi ? 

Après 4 réunions du collectif mis en place le 27 janvier 2016, pour accueillir les syndiqués en portage qui ont quitté l’entreprise dans le cadre du dernier PSE et les nouveaux retraités, il a été décidé, pour des raisons de clarté et de visibilité de reprendre le nom de SECTION DES RETRAITÉ(E)S CGT de la CHAPELLE-DARBLAY

Une réunion avec l’ancien bureau a eu lieu et certains souhaitent ne plus prendre de responsabilités afin d’assurer un renouvellement

 Un nouveau bureau a été constitué et  les camarades suivants ont été élus.

 A la direction, Gérard SÉNÉCAL & STEPHAN Christian

Aux finances DESAUNAY André & FRANÇOIS Francis

Comme membres DUVAL ÉRICK & DUHAMEL Daniel

Et le Président d’Honneur de la section le camarade ÉTIENNE René

 Il est décidé que le bureau se réunira 1 fois par mois et que le site des retraités sur le blog : cgtchapelledarblayupm.unblog.fr sera plus étoffé pour informer et coller plus à la réalité.

 Il est décidé également, dans le but de plus de fraternité et de convivialité de tenir LES REUNIONS dans les locaux de la CGT à Grand-Couronne et de fournir le matériel (cartes d’adhésion, Chasubles, etc…) pour être visibles dans les différentes manifestations auxquelles nous appellerons à participer.

 Le repas des retraités aura lieu le 30 juin 2016

 Le bureau continuera à établir des contacts nécessaires pour rassembler le plus de camarades dans la section, sachant que déjà une dizaine de camarades ont participé aux différentes réunions.

 

 Le bureau de la section.

 

*

*

*

*

*

*

*

*

*

 

*ma-retraite-cgt-mont-de-marsan

appel à manifestation.

Mobilisation nationale.

*

le 10 mars 2016 à 10h30 à Rouen devant le théâtre des arts.

*

fichier pdf 10-mars-2016-Appel-inter-organisations-76

ma-retraite-cgt-mont-de-marsan

 

Laisser un commentaire

 

ZONĂ LIBERĂ DE MA... |
Dekra Box - CFDT Industria... |
poureuxavanttout |
Unblog.fr | Créer un blog | Annuaire | Signaler un abus | corps des humbles
| PAIE ACTUALITY
| Ecole St Vincent de Paul de...